version
PlantPromoterDB promoter information of AK061123

Summary of Gene (AK061123)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0661600        NCBI 
Gene model AK061123  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 28582203-28581004)

Genome position     
from initiation codon
006-050-D12         
006-077-H06         
009-124-B10         
009-139-G08         
AK065465            
AK066432            
AK104664            
J013025A16          
J013064M13          
J013122O12          
J023066G24          
J033044A16          
J033144D14          
J090008O12          
J090018E01          
J090035D02          
J090078P13          
J090099P21          
TSS from cDNA
TSS information
AK061123                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061123

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-28581350-147
TSS clone peakGclone-28581346-143

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCGTGGGCCCGGG-2858145528581469-252-266
 OsREG443ACGCGTGG        PPDB Motif  PLACE Motif 
 OsREG530 CGCGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG602  GCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571   CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566     TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543      GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG539       GGCCCGGG PPDB Motif  PLACE Motif 
REGTCCGGCCCCACGCG-2858149828581511-295-308
 OsREG644TCCGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572    GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530      CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGACCGGGCC-2858154728581554-344-351
 OsREG441ACCGGGCC PPDB Motif  PLACE Motif 
REGCCTGGGCCCCACC-2858156628581578-363-375
 OsREG550CCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.