version
PlantPromoterDB promoter information of AK061141

Summary of Gene (AK061141)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0358000        NCBI 
Gene model AK061141  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 16972707-16971508)

Genome position     
from initiation codon
006-083-G07         
AK070900            
AK101263            
J023098C13          
J033032J06          
J065014A09          
J065121L01          
J065130K19          
J065208B21          
J075080G14          
J075135L01          
J075180J15          
TSS from cDNA
TSS information
AK061141                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061141

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-16971852-145
TSS clone peakGclone-16971784-77

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCCCACCAC-1697186316971872-156-165
 OsREG651GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527  CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCCCGTGGGCCCCACC-1697192216971936-215-229
 OsREG531CCCGTGGG        PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612       GCCCCACC PPDB Motif  PLACE Motif 
REGCCACCAAC-1697193816971945-231-238
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGGTCCACG-1697195716971964-250-257
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGCGGGTCCCACC-1697196816971978-261-271
 OsREG569CGGGTCCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 GGGTCCCA   PPDB MotifGGGACCC  PLACE Motif 
 OsREG650  GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651   GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGCTCGGCCCCACCAAC-1697202116972035-314-328
 OsREG575CTCGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC     PPDB Motif  PLACE Motif 
 OsREG612    GCCCCACC    PPDB Motif  PLACE Motif 
 OsREG520       CCACCAAC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.