version
PlantPromoterDB promoter information of AK061244

Summary of Gene (AK061244)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0798500        NCBI 
Gene model AK061244  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 35558038-35559237)

Genome position     
from initiation codon
006-106-C11         
AK068219            
J065199O16          
TSS from cDNA
TSS information
AK061244                         5'->3' (+)
Promoter sequence





 
                    
Os01g0798350        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061244

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35559001-37
TSS clone peakCclone+35559008-30

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTTGGGCT+3555873335558741-305-297
 OsREG479AGTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGAGTTGGGC+3555876535558772-273-266
 OsREG479AGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCAAGCCCATG+3555882935558839-209-199
 OsREG519CCAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG467   AGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCTGGGGCCCGCA+3555892635558937-112-101
 OsREG580CTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG567  GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG619   GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632    GGCCCGCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.