version
PlantPromoterDB promoter information of AK061339

Summary of Gene (AK061339)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0425800        NCBI 
Gene model AK061339  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 8: 20554118-20552919)

Genome position     
from initiation codon
009-168-F06         
AK101198            
J033030L06          
J100036D08          
J100052I22          
TSS from cDNA
TSS information
AK061339                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061339

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-20553169-51

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGACACGTGTC-2055323620553246-118-128
 OsREG451GGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCACGTGTCAGTGG-2055326020553274-142-156
 OsREG507GCCACGTG        PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 CCACGTGT       PPDB MotifACGT  PLACE Motif 
 OsREG509  CACGTGTC      PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG510      TGTCAGTG  PPDB Motif  PLACE MotifTGAC 
 OsREG522       GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGCCACTGACAGGTGGGTCC-2055329120553308-173-190
 OsREG522CCACTGAC           PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA          PPDB Motif  PLACE MotifTGAC 
 OsREG453  ACTGACAG         PPDB Motif  PLACE MotifTGAC 
 OsREG551   CTGACAGG        PPDB Motif  PLACE MotifTGAC 
 OsREG501     GACAGGTG      PPDB Motif  PLACE Motif 
 OsREG436      ACAGGTGG     PPDB Motif  PLACE Motif 
 OsREG514       CAGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG622          GTGGGTCC PPDB MotifGGGACCC  PLACE Motif 
REGTTTCGGCC-2055331820553325-200-207
 OsREG634TTTCGGCC PPDB Motif  PLACE Motif 
REGGAGGCGTG-2055335720553364-239-246
 OsREG503GAGGCGTG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.