version
PlantPromoterDB promoter information of AK061360

Summary of Gene (AK061360)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0191800        NCBI 
Gene model AK061360  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 4913620-4912421)

Genome position     
from initiation codon
AK102360            
J033091I08          
J033093F14          
TSS from cDNA
TSS information
AK061360                         5'->3' (-)
Promoter sequence














 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061360

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4912696-76
TSS clone peakGclone-4912659-39

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCCCTCCCCTCTCTCTCT-49126304912652-10-32
Y PatchCCTCCTCCCCC-49127064912716-86-96
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCCCCCA-49127054912712-85-92
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGGACCGTTG-49127444912751-124-131
 OsREG495GACCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGCGCACGCG-49127804912787-160-167
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 
REGGGGGCCCATAC-49128244912834-204-214
 OsREG647GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG489 GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGTCTCGGCCCAGTA-49128434912855-223-235
 OsREG635TCTCGGCC      PPDB Motif  PLACE Motif 
 OsREG575 CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565   CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454    GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604     GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGGTGGCCCATG-49128704912879-250-259
 OsREG653GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTCAGCCCA-49128974912904-277-284
 OsREG657TCAGCCCA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATAAAGGCCCACCT-49129114912929-291-309
 OsREG465AGCCCATA            PPDB MotifGCCCA  PLACE Motif 
 OsREG605 GCCCATAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG430        AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472         AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628          GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476           GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.