version
PlantPromoterDB promoter information of AK061365

Summary of Gene (AK061365)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0820700        NCBI 
Gene model AK061365  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 36120441-36121640)

Genome position     
from initiation codon
006-025-E04         
006-049-G11         
006-052-F06         
006-060-G08         
006-071-F06         
006-082-A05         
006-089-B06         
013-063-H08         
AK060869            
AK103008            
AK104724            
J013049H21          
J013089O10          
J013134D01          
J023065G24          
J033040M10          
J033076O17          
J033116I15          
J043027N22          
J065139I08          
J065165L17          
J065169P10          
J075031I15          
J075109M09          
J075132D23          
J100035B18          
J100036K11          
J100041D11          
J100044D24          
J100050D02          
J100058F20          
J100080J12          
J100082E08          
TSS from cDNA
TSS information
AK061365                         5'->3' (+)
Promoter sequence








 
AK066549            
J013070F02          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061365

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+36120987-454

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATGGGCCTC+3612084936120859-592-582
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCTA+3612086436120874-577-567
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCATAGCCCATA+3612089836120914-543-527
 OsREG487ATGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA        PPDB MotifGCCCA  PLACE Motif 
 OsREG465         AGCCCATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-36120823AK066549, J013070F02, AK066549

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAGGCCCATTA-3612086436120874AK066549, J013070F02
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGTATGGGCTATGGGCCAT-3612089836120914AK066549, J013070F02
 OsREG465TATGGGCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG630       TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488        ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487         TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGGTGTGGGGC-3612099036120998AK066549, J013070F02
 OsREG535GTGTGGGG  PPDB Motif  PLACE Motif 
 OsREG611 TGTGGGGC PPDB Motif  PLACE Motif 
REGGCGACGCG-3612109636121103AK066549, J013070F02
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.