version
PlantPromoterDB promoter information of AK061366

Summary of Gene (AK061366)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0867900        NCBI 
Gene model AK061366  
Description Protein of unknown function DUF502 family protein.  
#
#

Overview

Focused view (chromosome 1: 39344838-39343639)

Genome position     
from initiation codon
AK121441            
J023140N15          
J065077N20          
J065157K20          
J065181C20          
J075149B15          
J100030J07          
TSS from cDNA
TSS information
AK061366                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061366

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-39343962-124
TSS clone peakGclone-39343949-111

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTC-3934399639344004-158-166
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGCCACGTC-3934401139344021-173-183
 OsREG502CACGCCAC    PPDB Motif  PLACE Motif 
 OsREG448  CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585   GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGACTGACAGGTGGGGCC-3934402439344039-186-201
 OsREG453ACTGACAG         PPDB Motif  PLACE MotifTGAC 
 OsREG551 CTGACAGG        PPDB Motif  PLACE MotifTGAC 
 OsREG501   GACAGGTG      PPDB Motif  PLACE Motif 
 OsREG436    ACAGGTGG     PPDB Motif  PLACE Motif 
 OsREG514     CAGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG612       GGTGGGGC  PPDB Motif  PLACE Motif 
 OsREG631        GTGGGGCC PPDB Motif  PLACE Motif 
REGGCCACGTGGCGGACGGC-3934406439344080-226-242
 OsREG507GCCACGTGGC        PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448   ACGTGGCG       PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG562         CGGACGGC PPDB Motif  PLACE Motif 
REGCGCGTCGCAGGTGGGTCCCACCTG-3934409839344121-260-283
 OsREG559CGCGTCGC                 PPDB Motif  PLACE MotifCGACG 
 OsREG514       CAGGTGGG CCCACCTG PPDB MotifGCCCA  PLACE Motif 
 OsREG622          GTGGGTCC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG637           TGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648            GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650             GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651              GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
REGCGACACGTG-3934412639344134-288-296
 OsREG452CGACACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCACGGCC-3934413939344146-301-308
 OsREG521CCACGGCC PPDB Motif  PLACE Motif 
REGCCAGCCCAAAC-3934420739344217-369-379
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGGCC-3934422739344234-389-396
 OsREG539CCCGGGCC PPDB Motif  PLACE Motif 
REGCGTTCCGT-3934423939344246-401-408
 OsREG444CGTTCCGT PPDB Motif  PLACE Motif 
REGCGGCCCACCCG-3934425239344262-414-424
 OsREG564CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600  GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528   CCCACCCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.