version
PlantPromoterDB promoter information of AK061374

Summary of Gene (AK061374)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0854000        NCBI 
Gene model AK061374  
Description Protein of unknown function UPF0131 family protein.  
#
#

Overview

Focused view (chromosome 3: 36823339-36824538)

Genome position     
from initiation codon
009-186-C03         
J065138B11          
TSS from cDNA
TSS information
AK061374                         5'->3' (+)
Promoter sequence









 
015-077-D03         
AK064339            
AK103879            
J033149N19          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061374

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+36824285-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTC+3682424236824249-97-90
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCATG+3682410336824112-236-227
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCAAGGCCC+3682411636824123-223-216
 OsREG497CAAGGCCC PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCGCA+3682412836824139-211-200
 OsREG594TGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643    GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCATAT+3682415836824168-181-171
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCTGG+3682417236824182-167-157
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGGGCTGGGCCCACGCG+3682420736824221-132-118
 OsREG603GGCTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG620 GCTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG602      GCCCACGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG530       CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGGCGGGCCCACCT+3682423336824244-106-95
 OsREG619GCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476    GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.