version
PlantPromoterDB promoter information of AK061682

Summary of Gene (AK061682)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0822700        NCBI 
Gene model AK061682  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 35386229-35387428)

Genome position     
from initiation codon
                    
005-010-E01         
AK101448            
J013056F03          
J023090P18          
J023091N05          
J023127G10          
J033039M12          
J033043D18          
J065053E23          
J065148E23          
J065170F24          
J090048J19          
Os03g0822500        
TSS from cDNA
TSS information
AK061682                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061682

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+35387013-216

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC+3538704935387056-180-173
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGGCCCACCA+3538689835386910-331-319
 OsREG633TCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599     GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCCAAT+3538692735386939-302-290
 OsREG476AGGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492     GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGG+3538694435386951-285-278
 OsREG450ACGTGGGG PPDB MotifACGT  PLACE Motif 
REGGACGGCCCGGCCC+3538696035386972-269-257
 OsREG584GACGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG     PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG    PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC   PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.