version
PlantPromoterDB promoter information of AK061717

Summary of Gene (AK061717)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0115500        NCBI 
Gene model AK061717  
Description CBS domain containing protein.  
#
#

Overview

Focused view (chromosome 9: 1172305-1171106)

Genome position     
from initiation codon
006-023-A12         
006-042-G01         
AK065986            
J013043C13          
J013111D13          
J023114K12          
J065102N18          
TSS from cDNA
TSS information
AK061717                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061717

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1171449-144

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCAGCCCAGCC-11715741171584-269-279
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCCCATGT-11715971171610-292-305
 OsREG553CGATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517     GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437      GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGGCCCATCA-11716231171630-318-325
 OsREG607GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGCCCATGT-11716351171642-330-337
 OsREG437GCCCATGT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.