version
PlantPromoterDB promoter information of AK061752

Summary of Gene (AK061752)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0654500        NCBI 
Gene model AK061752  
Description Similar to NADP-isocitrate dehydrogenase.  
#
#

Overview

Focused view (chromosome 1: 28293868-28292669)

Genome position     
from initiation codon
006-048-A06         
006-053-E10         
013-057-E05         
015-005-F01         
015-010-E10         
AF155333            
D21069              
J013037K16          
J013120I21          
J013156A05          
J013169P22          
J023022K05          
J023023A16          
J023026J09          
J023030P19          
J023052L15          
J023103O10          
J023127L08          
J023140A20          
J033093D15          
J033108D03          
J033108H14          
J033112E06          
J043010M08          
J043020I12          
J043026J19          
J075118O08          
J075173H11          
J090001E10          
J090008D17          
J090021J03          
J090021M20          
J090027E04          
J090033J10          
J090033P20          
J090034B07          
J090036J22          
J090050H01          
J090053J07          
J090053K01          
J090067C07          
J090070N01          
J090076I12          
J090083B16          
J090097A17          
J100019A20          
J100022D05          
J100022D07          
J100025N08          
J100027E03          
J100027O21          
J100028O06          
J100031A04          
J100033L05          
J100035F03          
J100040F20          
J100051H23          
J100052P18          
J100060K04          
J100061P07          
J100063E04          
J100069F15          
J100073F18          
J100078P16          
TSS from cDNA
TSS information
AK061752                         5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK061752

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28292954-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCC-2829294328292951-75-83
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAACT-2829299628293003-128-135
 OsREG479GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGCCCACCCG-2829302428293031-156-163
 OsREG528CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGGACCCA-2829303728293051-169-183
 OsREG501GACAGGTG        PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG       PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG651    GGTGGGAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG650     GTGGGACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648      TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637       GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGCAAGTGGGCCCCACG-2829311628293130-248-262
 OsREG498CAAGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572       GCCCCACG PPDB Motif  PLACE Motif 
REGGCCCACCAAC-2829315328293162-285-294
 OsREG599GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520  CCACCAAC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.