version
PlantPromoterDB promoter information of AK062012

Summary of Gene (AK062012)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0506000        NCBI 
Gene model AK062012  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 25058901-25060100)

Genome position     
from initiation codon
AF031609            
AK098900            
AK122090            
J013002B13          
J023149G13          
J033123O20          
J080315O17          
TSS from cDNA
TSS information
AK062012                         5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK062012

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+25058560-91
TSS clone peakGclone+25058567-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCCTCCCC+2505852925058545-122-106
Y PatchTCTCTCTCTCTCTCTCTCT+2505859525058613-56-38
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGTGGCCCATCG+2505832625058339-325-312
 OsREG573CGTGTGGC       PPDB Motif  PLACE Motif 
 OsREG653   GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488    TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590     GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553      GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGCACGTCACC+2505836925058377-282-274
 OsREG505CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447 ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 
REGCGACACGTGACGCGAC+2505841225058427-239-224
 OsREG452CGACACGT         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG        PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG583        GACGCGAC PPDB Motif  PLACE Motif 
REGCCGTCGGATCAGGCCCCGCGTCGC+2505843325058456-218-195
 OsREG546CCGTCGGA                 PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT                PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC               PPDB MotifCCGAC  PLACE Motif 
 OsREG646        TCAGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG559                CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCCCACGAA+2505847125058478-180-173
 OsREG529CCCACGAA PPDB MotifGCCCA  PLACE Motif 
REGCCCACTCCCCCA+2505850925058520-142-131
 OsREG532CCCACTCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG574    CTCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.