version
PlantPromoterDB promoter information of AK062369

Summary of Gene (AK062369)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0571400        NCBI 
Gene model AK062369  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 5: 28565460-28564261)

Genome position     
from initiation codon
009-019-B04         
009-043-H02         
TSS from cDNA
TSS information
AK062369                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK062369

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-28564481-21

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGGCCCGGCCCAGTT-2856452828564544-68-84
 OsREG584GACGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG         PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG        PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565       CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454        GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG425         GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCGA-2856455828564568-98-108
 OsREG605TTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATGCGGCCCAAAA-2856458228564599-122-139
 OsREG467AGCCCATG           PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG643      TGCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG618       GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563        CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625         GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592          GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGGTGGCCCAGAT-2856461428564624-154-164
 OsREG653GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.