version
PlantPromoterDB promoter information of AK063054

Summary of Gene (AK063054)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0728600        NCBI 
Gene model AK063054  
Description Similar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).  
#
#

Overview

Focused view (chromosome 2: 31213460-31212261)

Genome position     
from initiation codon
009-163-H09         
J065121P04          
TSS from cDNA
TSS information
AK063054                         5'->3' (-)
Promoter sequence








 
AK109840            
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063054

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-31212527-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTCCCAC-3121257331212580-113-120
 OsREG650GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCTGACAGGTGGGCCTA-3121259031212605-130-145
 OsREG551CTGACAGG         PPDB Motif  PLACE MotifTGAC 
 OsREG501  GACAGGTG       PPDB Motif  PLACE Motif 
 OsREG436   ACAGGTGG      PPDB Motif  PLACE Motif 
 OsREG514    CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476     AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472       GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656        TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGTGGTGGGC-3121270231212710-242-250
 OsREG527GTGGTGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGCCGTTGG-3121276931212776-309-316
 OsREG518GCCGTTGG PPDB MotifCCAACGG  PLACE Motif 
REGGCGTCGCG-3121277931212786-319-326
 OsREG556GCGTCGCG PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.