version
PlantPromoterDB promoter information of AK063189

Summary of Gene (AK063189)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0119500        NCBI 
Gene model AK063189  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 1140239-1139040)

Genome position     
009-125-C06         
AK065035            
J013001H07          
J013128B11          
J013153L13          
J013157F08          
J065140L14          
J075147J12          
J090087C14          
J100048O09          
J100051O16          
J100083H22          
TSS from cDNA
TSS information
AK063189                         5'->3' (-)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063189

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-1139239AK065035, J090087C14, J100048O09, J065140L14, J100083H22, J075147J12, AK065035, J013001H07, J013153L13, J100051O16, J013157F08, AK061898, J013128B11, AJ698084
TSS clone peakAclone-1139110AK065035, J090087C14, J100048O09, J065140L14, J100083H22, J075147J12, AK065035, J013001H07, J013153L13, J100051O16, J013157F08, AK061898, J013128B11, AJ698084

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCCTC-11391911139198AJ698084, AK061898, AK065035, J013001H07, J013128B11, J013153L13, J013157F08, J065140L14, J075147J12, J090087C14, J100048O09, J100051O16, J100083H22
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCACCGCAC-11392381139245AJ698084, AK061898, AK065035, J013001H07, J013128B11, J013153L13, J013157F08, J065140L14, J075147J12, J090087C14, J100048O09, J100051O16, J100083H22
 OsREG500CACCGCAC PPDB Motif  PLACE Motif 
REGATCCCCCACG-11392581139267AJ698084, AK061898, AK065035, J013001H07, J013128B11, J013153L13, J013157F08, J065140L14, J075147J12, J090087C14, J100048O09, J100051O16, J100083H22
 OsREG482ATCCCCCA   PPDB Motif  PLACE Motif 
 OsREG536  CCCCCACG PPDB Motif  PLACE Motif 
REGCCCCACACG-11394301139438AJ698084, AK061898, AK065035, J013001H07, J013128B11, J013153L13, J013157F08, J065140L14, J075147J12, J090087C14, J100048O09, J100051O16, J100083H22
 OsREG535CCCCACAC  PPDB Motif  PLACE Motif 
 OsREG526 CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGCACACACC-11395101139517AJ698084, AK061898, AK065035, J013001H07, J013128B11, J013153L13, J013157F08, J065140L14, J075147J12, J090087C14, J100048O09, J100051O16, J100083H22
 OsREG499CACACACC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.