version
PlantPromoterDB promoter information of AK063411

Summary of Gene (AK063411)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0348800        NCBI 
Gene model AK063411  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 9: 11547191-11545992)

Genome position     
from initiation codon
011-097-D10         
J065037E16          
TSS from cDNA
TSS information
AK063411                         5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063411

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-11546987-796

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCTCTC-1154694711546955-756-764
Y PatchTTCCTCTT-1154699311547000-802-809
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACGGCCCACCTGTGGGCCCAAAC-1154705611547080-865-889
 OsREG521CCACGGCC                  PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA                PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC               PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC              PPDB MotifGCCCA  PLACE Motif 
 OsREG476     GCCCACCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG514      CCCACCTG            PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT           PPDB Motif  PLACE Motif 
 OsREG627            TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640             GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639               GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625                GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593                 GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTGGGACCCAC-1154726111547270-1070-1079
 OsREG648TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622  GGACCCAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.