version
PlantPromoterDB promoter information of AK063499

Summary of Gene (AK063499)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0391100        NCBI 
Gene model AK063499  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 16774683-16773484)

Genome position     
from initiation codon
012-001-B05         
012-053-F01         
J065021A04          
J065076H06          
J065181E05          
J065187A05          
J075036C17          
J075051C18          
J075063L16          
J075079M08          
J075112H15          
J075135F10          
J075164H06          
J075195N02          
TSS from cDNA
TSS information
AK063499                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063499

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-16773979-296

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGAGCCG-1677402316774030-340-347
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGCGCGACGCGTGGCCGAGACGTGGC-1677403516774058-352-375
 OsREG556CGCGACGC                 PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG                PPDB Motif  PLACE MotifCGACG 
 OsREG443    ACGCGTGG             PPDB Motif  PLACE Motif 
 OsREG635          GGCCGAGA       PPDB Motif  PLACE Motif 
 OsREG506              GAGACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG585                GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCTGGGCCCACTTG-1677415316774166-470-483
 OsREG550CCTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478    GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498      CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGTCTGGACC-1677419916774206-516-523
 OsREG649TCTGGACC PPDB Motif  PLACE Motif 
REGGCCCACCTG-1677420916774217-526-534
 OsREG476GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514 CCCACCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.