version
PlantPromoterDB promoter information of AK063559

Summary of Gene (AK063559)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0159700        NCBI 
Gene model AK063559  
Description Protein prenyltransferase domain containing protein.  
#
#

Overview

Focused view (chromosome 3: 3164142-3165341)

Genome position     
from initiation codon
012-100-B09         
J065197I24          
J090089G20          
TSS from cDNA
TSS information
AK063559                         5'->3' (+)
Promoter sequence






 
AK106743            
J075041K15          
J075051E03          
J075055P19          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063559

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+3165118-24

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGACGTGTGGCCCATAC+31649993165016-143-126
 OsREG505GTGACGTG           PPDB MotifACGT  PLACE MotifTGAC 
 OsREG573    CGTGTGGC       PPDB Motif  PLACE Motif 
 OsREG653       GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488        TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630         GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606          GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCGTA+31650503165061-92-81
 OsREG592TTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645    GGGCCGTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-3164272AK106743, AK106743, J075051E03, J075055P19, J075041K15, J075096D01

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC-31642743164281AK106743, J075041K15, J075051E03, J075055P19, J075096D01
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCACCTGTC-31643313164338AK106743, J075041K15, J075051E03, J075055P19, J075096D01
 OsREG501CACCTGTC PPDB Motif  PLACE Motif 
REGGCCCACGT-31643543164361AK106743, J075041K15, J075051E03, J075055P19, J075096D01
 OsREG449GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGTCGCGCGCGAC-31643703164380AK106743, J075041K15, J075051E03, J075055P19, J075096D01
 OsREG617TCGCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG557   CGCGCGAC PPDB MotifACGCGC  PLACE Motif 
REGCCAACGGCGTCCGAT-31645273164541AK106743, J075041K15, J075051E03, J075055P19, J075096D01
 OsREG518CCAACGGC        PPDB MotifCCAACGG  PLACE Motif 
 OsREG484       CGTCCGAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.