version
PlantPromoterDB promoter information of AK063685

Summary of Gene (AK063685)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0649300        NCBI 
Gene model AK063685  
Description Similar to Short highly repeated, interspersed DNA (Fragment).  
#
#

Overview

Focused view (chromosome 2: 27029272-27030471)

Genome position     
from initiation codon
014-043-A05         
TSS from cDNA
TSS information
AK063685                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063685

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+27030172-100
TSS clone peakAclone+27030180-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGTATAAAAG+2703013827030147-134-125
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGTGT+2702997627029985-296-287
 OsREG448CGCCACGT   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT PPDB MotifACGT  PLACE Motif 
REGGTGTGGGGGC+2703003327030042-239-230
 OsREG535GTGTGGGG   PPDB Motif  PLACE Motif 
 OsREG613  GTGGGGGC PPDB Motif  PLACE Motif 
REGGGTGGGGCCCACGCGT+2703007927030094-193-178
 OsREG612GGTGGGGC         PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC        PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG    PPDB MotifGCCCA  PLACE Motif 
 OsREG602      GCCCACGC   PPDB MotifGCCCA  PLACE Motif 
 OsREG530       CCCACGCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG443        CCACGCGT PPDB Motif  PLACE Motif 
REGGCCACGTGTCG+2703011627030126-156-146
 OsREG507GCCACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509  CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452   ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.