version
PlantPromoterDB promoter information of AK063740

Summary of Gene (AK063740)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0590300        NCBI 
Gene model AK063740  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 24686217-24687416)

Genome position     
from initiation codon
014-089-E04         
TSS from cDNA
TSS information
AK063740                         5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063740

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+24687098-119

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCCCCA+2468683224686839-385-378
 OsREG482ATCCCCCA PPDB Motif  PLACE Motif 
REGCGGGTGGGCCGGG+2468687224686884-345-333
 OsREG528CGGGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG600 GGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG538     GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGTGGGGCCC+2468691324686920-304-297
 OsREG641TGGGGCCC PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCACA+2468693724686946-280-271
 OsREG435ACAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCAGC+2468695324686963-264-254
 OsREG419AAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG428  AAGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG464   AGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAACA+2468696524686973-252-244
 OsREG458AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594 GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCTGA+2468701424687024-203-193
 OsREG525CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.