version
PlantPromoterDB promoter information of AK063836

Summary of Gene (AK063836)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0642900        NCBI 
Gene model AK063836  
Description Single-strand binding protein/Primosomal replication protein n family protein.  
#
#

Overview

Focused view (chromosome 1: 27600307-27599108)

Genome position     
from initiation codon
009-109-F01         
AK073560            
J033043K18          
J100023C05          
J100038C15          
J100039C23          
TSS from cDNA
TSS information
AK063836                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063836

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-27599340-33
TSS clone peakCclone-27599333-26

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCT-27599286275992942113
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGCCCAAA-2759940227599411-95-104
 OsREG658TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGAAACGGCCCATAT-2759942127599433-114-126
 OsREG420AAACGGCC      PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423 AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630    GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480     GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCG-2759944027599447-133-140
 OsREG568TCGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGGAGGCCCAAAA-2759945927599469-152-162
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGACCGGGCCGGA-2759951727599527-210-220
 OsREG441ACCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG644   GGGCCGGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.