version
PlantPromoterDB promoter information of AK063846

Summary of Gene (AK063846)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0529400        NCBI 
Gene model AK063846  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 5: 26352800-26353999)

Genome position     
from initiation codon
009-126-H06         
AK122038            
J033113C01          
TSS from cDNA
TSS information
AK063846                         5'->3' (+)
Promoter sequence







 
014-093-D12         
AK102648            
J033100L05          
J080315E10          
J090037H11          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence







 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063846

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26353598-202
TSS clone peakAclone+26353694-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC+2635367926353686-121-114
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGGCCCACA+2635331126353320-489-480
 OsREG475AGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCGTGGACC+2635339226353399-408-401
 OsREG570CGTGGACC PPDB Motif  PLACE Motif 
REGCGTGGGGCCCACT+2635340226353414-398-386
 OsREG572CGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCCCGC+2635347126353482-329-318
 OsREG449ACGTGGGC     PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG  PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGGGTGACGTGGCG+2635349026353501-310-299
 OsREG447GGTGACGT     PPDB MotifACGT  PLACE MotifTGAC 
 OsREG505 GTGACGTG    PPDB MotifACGT  PLACE MotifTGAC 
 OsREG585   GACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448    ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGGTGACGTCACC+2635352026353531-280-269
 OsREG447GGTGACGTCACC PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-26353224AK102648, AK102648

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCC-2635322526353232AK102648
Y PatchCCCCTTCC-2635326426353271AK102648
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGTCCACG-2635329226353299AK102648
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGTGTGGGCCCT-2635331126353320AK102648
 OsREG627TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475  TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGGGTCCACG-2635339226353399AK102648
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGAGTGGGCCCCACG-2635340226353414AK102648
 OsREG478AGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572     GCCCCACG PPDB Motif  PLACE Motif 
REGGCGGGCCCACGT-2635347126353482AK102648
 OsREG619GCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449    GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGCGCCACGTCACC-2635349026353501AK102648
 OsREG448CGCCACGT     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447    ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.