version
PlantPromoterDB promoter information of AK063941

Summary of Gene (AK063941)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0683900        NCBI 
Gene model AK063941  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 6: 29369978-29371177)

Genome position     
from initiation codon
AK110639            
TSS from cDNA
TSS information
AK063941                         5'->3' (+)
Promoter sequence





 
                    
Os06g0683850        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK063941

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29372280-298
TSS clone peakAclone+29372282-296

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCTC+2937225929372268-319-310
Y PatchCCCCCTCCT+2937227029372278-308-300
Y PatchTCCTCCCCTTCC+2937228629372297-292-281
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGATG+2937206029372067-518-511
 OsREG515GGTGGATG PPDB Motif  PLACE Motif 
REGCCCACCACACACC+2937210229372114-476-464
 OsREG527CCCACCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG499     CACACACC PPDB Motif  PLACE Motif 
REGCAACGGTC+2937222729372234-351-344
 OsREG495CAACGGTC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+29370189AK110639, AK110639

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCCCTATATAAC+2937015129370162AK110639
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTCGAGTC+2936998429369991AK110639
 OsREG586GTCGAGTC PPDB Motif  PLACE Motif 
REGCACCGCAC+2937001729370024AK110639
 OsREG500CACCGCAC PPDB Motif  PLACE Motif 
REGCCGAGCCG+2937009029370097AK110639
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGCACGTCACGTCACC+2937010729370120AK110639
 OsREG505CACGTCACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447      ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.