version
PlantPromoterDB promoter information of AK064024

Summary of Gene (AK064024)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0685900        NCBI 
Gene model AK064024  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 30038093-30039292)

Genome position     
from initiation codon
012-082-H04         
AK102005            
J033061C02          
J033076D05          
J033079N16          
J033101M16          
J090007L17          
J090021N06          
J090056C22          
J090061P06          
TSS from cDNA
TSS information
AK064024                         5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064024

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+30038659-434

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCTCC+3003866530038673-428-420
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGGGCC+3003842530038432-668-661
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAATGGGCCCCACCTGTCAGT+3003846730038486-626-607
 OsREG431AATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG489 ATGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC         PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC        PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG      PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT     PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC    PPDB Motif  PLACE Motif 
 OsREG551           CCTGTCAG  PPDB Motif  PLACE MotifTGAC 
 OsREG453            CTGTCAGT PPDB Motif  PLACE MotifTGAC 
REGCCCACGTGTCC+3003850330038513-590-580
 OsREG508CCCACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG434 CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509  CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451   ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCCCAATT+3003857530038582-518-511
 OsREG433GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGA+3003859230038599-501-494
 OsREG633GGCCCGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.