version
PlantPromoterDB promoter information of AK064384

Summary of Gene (AK064384)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0711600        NCBI 
Gene model AK064384  
Description mRNA splicing factor SYF2 family protein.  
#
#

Overview

Focused view (chromosome 6: 30963227-30964426)

Genome position     
from initiation codon
016-047-G09         
AK102831            
J013072P18          
J023049G01          
J023088I01          
J033023I22          
J033106I12          
J033109G07          
J065030F22          
J065132H19          
J080301D07          
J080305C09          
J080312C03          
J080313I15          
J080315B09          
J090056N21          
J100027B07          
TSS from cDNA
TSS information
AK064384                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064384

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+30964167-60
TSS clone peakAclone+30964195-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGTGGGG+3096387330963880-354-347
 OsREG535GTGTGGGG PPDB Motif  PLACE Motif 
REGTCATGGGCTGG+3096403930964049-188-178
 OsREG609TCATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG PPDB MotifGCCCA  PLACE Motif 
REGCATGGGCCTTG+3096406530964075-162-152
 OsREG517CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474 ATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG430  TGGGCCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG497   GGGCCTTG PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGCCAA+3096408230964092-145-135
 OsREG600GGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGTTCGGCCCGGT+3096409930964109-128-118
 OsREG642TTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG568 TCGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441   GGCCCGGT PPDB Motif  PLACE Motif 
REGGAAGCCCACCAC+3096411230964123-115-104
 OsREG582GAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.