version
PlantPromoterDB promoter information of AK064390

Summary of Gene (AK064390)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0128400        NCBI 
Gene model AK064390  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 1502350-1503549)

Genome position     
from initiation codon
016-060-G03         
AK121983            
J033108N24          
TSS from cDNA
TSS information
AK064390                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064390

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+1503212-138

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGGGCCCAGAT+15030251503037-325-313
 OsREG424AACGGGCC      PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG579   GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629    GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486     GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCAGC+15030461503055-304-295
 OsREG430AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGAATGGGCTGATAAGCCCATGG+15030661503086-284-264
 OsREG432AATGGGCT              PPDB MotifGCCCA  PLACE Motif 
 OsREG491 ATGGGCTG             PPDB MotifGCCCA  PLACE Motif 
 OsREG657  TGGGCTGA            PPDB MotifGCCCA  PLACE Motif 
 OsREG655          TAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429           AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG467            AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525             GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGTGGCCCACC+15030911503100-259-250
 OsREG653GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGG+15031171503125-233-225
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGATCCAACGGC+15031451503154-205-196
 OsREG481ATCCAACG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.