version
PlantPromoterDB promoter information of AK064391

Summary of Gene (AK064391)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0209100        NCBI 
Gene model AK064391  
Description Cyclin-like F-box domain containing protein.  
#
#

Overview

Focused view (chromosome 11: 5598657-5597458)

Genome position     
from initiation codon
016-063-F03         
AK106902            
J065055I16          
J065121H06          
J065171H11          
J075027K02          
J075105K12          
J075131F16          
J075154K15          
J075189N19          
J075199O15          
TSS from cDNA
TSS information
AK064391                         5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064391

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-5597996-339

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATTGGGCC-55980365598044-379-387
 OsREG433AATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCGTT-55980585598068-401-411
 OsREG644TCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGATGGCCCACGCTTGTGGGCCTG-55980745598095-417-438
 OsREG487ATGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC              PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG             PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG597           TTGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627            TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472             GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513              TGGGCCTG PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCCAGC-55981085598120-451-463
 OsREG422AAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GGCCCAGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.