version
PlantPromoterDB promoter information of AK064609

Summary of Gene (AK064609)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0136300        NCBI 
Gene model AK064609  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 7: 1943344-1944543)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK064609                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064609

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+1944235-109

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTGGGCCGAA+19440141944024-330-320
 OsREG620GCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642   GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGGTCGCGCGTGGGCCGAGA+19440291944046-315-298
 OsREG557GTCGCGCG           PPDB MotifACGCGC  PLACE Motif 
 OsREG530    CGCGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG602     GCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571      CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG564       GTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658        TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575         GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635          GGCCGAGA PPDB Motif  PLACE Motif 
REGCAACGGTC+19440641944071-280-273
 OsREG495CAACGGTC PPDB MotifCCAACGG  PLACE Motif 
REGCGGGTGGGACC+19441341944144-210-200
 OsREG528CGGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG651  GGTGGGAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GTGGGACC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.