version
PlantPromoterDB promoter information of AK064628

Summary of Gene (AK064628)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0625500        NCBI 
Gene model AK064628  
Description Similar to Fimbriata-associated protein (Fragment).  
#
#

Overview

Focused view (chromosome 7: 26566908-26568107)

Genome position     
from initiation codon
J065154A13          
J065188C09          
TSS from cDNA
TSS information
AK064628                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064628

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26567811-97

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCGCTATAAAAA+2656777626567787-132-121
Y PatchCCTCCTCC+2656776826567775-140-133
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATGGGCTGA+2656758426567594-324-314
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCATT+2656761026567619-298-289
 OsREG657TCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGCCCAACA+2656763926567650-269-258
 OsREG638TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCACGCCTC+2656774426567751-164-157
 OsREG503CACGCCTC PPDB Motif  PLACE Motif 
REGCTCTCCGC+2656776126567768-147-140
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.