version
PlantPromoterDB promoter information of AK064750

Summary of Gene (AK064750)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0803600        NCBI 
Gene model AK064750  
Description Longin-like domain containing protein.  
#
#

Overview

Focused view (chromosome 2: 35149927-35151126)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK064750                         5'->3' (+)
Promoter sequence






 
AK108222            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064750

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35150844-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxACTATATA+3515080935150816-118-111
Y PatchTCCTCCTCT+3515084635150854-81-73
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACCAAC+3515060435150611-323-316
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGACGTCACC+3515061335150620-314-307
 OsREG447ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 
REGAGCCCATGA+3515064935150657-278-270
 OsREG467AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609 GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGACAGGTGGGCCCC+3515070135150713-226-214
 OsREG436ACAGGTGG      PPDB Motif  PLACE Motif 
 OsREG514 CAGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG476  AGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647     TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCCA+3515073435150744-193-183
 OsREG627TGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.