version
PlantPromoterDB promoter information of AK064887

Summary of Gene (AK064887)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0542200        NCBI 
Gene model AK064887  
Description Thioredoxin fold domain containing protein.  
#
#

Overview

Focused view (chromosome 9: 22190377-22189178)

Genome position     
from initiation codon
006-092-A09         
AK104804            
J013000K12          
J013170A19          
J033103B02          
J065196J20          
J075037H17          
J075069H14          
J075071C16          
J075095N02          
J075136N03          
J075192L16          
J100057N23          
J100060O07          
J100062F10          
J100077I08          
J100086B07          
J100088L14          
TSS from cDNA
TSS information
AK064887                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064887

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-22189452-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCC-2218947422189485-97-108
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCGATCCG-2218952822189540-151-163
 OsREG541CCGATCCGATCCG PPDB Motif  PLACE Motif 
REGAGTGGGCCTT-2218955122189560-174-183
 OsREG478AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430  TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCATT-2218957422189583-197-206
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCAGA-2218961022189621-233-244
 OsREG480ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCCAAAT-2218963022189643-253-266
 OsREG456AGATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625     GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493      GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.