version
PlantPromoterDB promoter information of AK064933

Summary of Gene (AK064933)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0778700        NCBI 
Gene model AK064933  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 1: 34712163-34713362)

Genome position     
from initiation codon
003-130-G08         
012-073-B11         
J013000O19          
J065036B01          
J065098J21          
J090015O22          
J090073J19          
TSS from cDNA
TSS information
AK064933                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK064933

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34712841-322

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCCC+3471286834712876-295-287
Y PatchCCTCCTCCT+3471288134712889-282-274
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACTGACA+3471257634712583-587-580
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGGCGGGCCCACCTG+3471258634712598-577-565
 OsREG619GCGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476    GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514     CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCGC+3471262834712636-535-527
 OsREG558CTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617 TCGCGCGC PPDB Motif  PLACE Motif 
REGGTGTCACT+3471270334712710-460-453
 OsREG477GTGTCACT PPDB Motif  PLACE MotifTGAC 
REGGGTGGGGCCCACCA+3471271634712729-447-434
 OsREG612GGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599      GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCGTGGGTCCC+3471273834712751-425-412
 OsREG503GAGGCGTG       PPDB Motif  PLACE Motif 
 OsREG622     GTGGGTCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637      TGGGTCCC PPDB MotifGGGACCC  PLACE Motif 
REGGCGCGCGAG+3471276534712773-398-390
 OsREG617GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG558 CGCGCGAG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.