version
PlantPromoterDB promoter information of AK065144

Summary of Gene (AK065144)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0354400        NCBI 
Gene model AK065144  
Description Protein of unknown function DUF231, plant domain containing protein.  
#
#

Overview

Focused view (chromosome 5: 16765265-16764066)

Genome position     
from initiation codon
J013002A20          
J013132I10          
TSS from cDNA
TSS information
AK065144                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK065144

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-16764464-199

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTCTCCTCTC-1676444416764459-179-194
Y PatchCCCCCCTC-1676450216764509-237-244
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACAC-1676451016764517-245-252
 OsREG535CCCCACAC PPDB Motif  PLACE Motif 
REGCAGGTGGGCCCACCC-1676454316764557-278-292
 OsREG514CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600       GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGACCCA-1676456216764572-297-307
 OsREG651GGTGGGAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG637   GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGCCCCACAC-1676469016764697-425-432
 OsREG535CCCCACAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.