version
PlantPromoterDB promoter information of AK065219

Summary of Gene (AK065219)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0326600        NCBI 
Gene model AK065219  
Description Similar to GMP synthetase.  
#
#

Overview

Focused view (chromosome 8: 14444068-14445267)

Genome position     
from initiation codon
011-095-A07         
J013002G12          
J013124M03          
J013146C04          
J023039H05          
J023113D02          
J033023G02          
J033033O17          
J033040L21          
J033055O15          
J033058I22          
J033087G02          
J033127K17          
J033132G08          
J033138L17          
J053054J19          
J065001C04          
J090030C11          
J090060N23          
J090061I24          
J090087G03          
J100023J20          
J100046M13          
J100059B21          
J100065N19          
J100072J06          
TSS from cDNA
TSS information
AK065219                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK065219

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+14444986-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGACGTGTCG+1444488314444893-185-175
 OsREG506GAGACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG452   ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGGGTCCCACCTGTCAG+1444492514444941-143-127
 OsREG637TGGGTCCC          PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 GGGTCCCA         PPDB MotifGGGACCC  PLACE Motif 
 OsREG650  GGTCCCAC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG651   GTCCCACC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG514     CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436      CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501       CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551         CCTGTCAG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.