version
PlantPromoterDB promoter information of AK065254

Summary of Gene (AK065254)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0479400        NCBI 
Gene model AK065254  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 17723289-17722090)

Genome position     
from initiation codon
012-095-H10         
AK067061            
J013002J11          
J013059D02          
J013072G21          
J013075C01          
J013160P03          
J023041G11          
J023099P13          
J043013F08          
J065045K15          
J075161N23          
J075169D24          
J090008A20          
J090012H20          
J090016F15          
J090023A17          
J090024G22          
J090037J21          
J090041H10          
J090051I16          
J090062N01          
J090063I12          
J090072B01          
J090075J05          
J090079H02          
J090084D20          
J090097G15          
TSS from cDNA
TSS information
AK065254                         5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK065254

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-17722428-139

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCTT-1772242617722434-137-145
Y PatchCCTCCTCC-1772243917722446-150-157
Y PatchCTCCTCCTCC-1772246917722478-180-189
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACACACCCCCACACCCACCACCCCACAC-1772258217722610-293-321
 OsREG499CACACACC                      PPDB Motif  PLACE Motif 
 OsREG535       CCCCACAC      CCCCACAC PPDB Motif  PLACE Motif 
 OsREG527              CCCACCAC        PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAAA-1772265317722662-364-373
 OsREG421AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAAGCCCAGCCCAACC-1772269717722718-408-429
 OsREG421AAAGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG459  AGCCCAAG             PPDB MotifGCCCA  PLACE Motif 
 OsREG519     CCAAGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG496      CAAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG428       AAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464        AGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603         GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533          CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523           CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511            CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458             AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595              GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAAG-1772272117722728-432-439
 OsREG459AGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.