version
PlantPromoterDB promoter information of AK065467

Summary of Gene (AK065467)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0212100        NCBI 
Gene model AK065467  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 6110870-6112069)

Genome position     
from initiation codon
AK101456            
J013043A03          
J013058L16          
J013128N05          
J023039M21          
J023058A05          
J023109E02          
J033040B09          
J033051E16          
J033115D02          
J033144C05          
J033145C05          
J090008J12          
J090072L19          
J090078F13          
J090093D16          
TSS from cDNA
TSS information
AK065467                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK065467

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+6111826-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCC+61118306111837-40-33
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGATCGG+61115356111542-335-328
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGAGCCCATCCAAGGTGGGCCCAAAT+61117266111749-144-121
 OsREG466AGCCCATC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GCCCATCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG534  CCCATCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG476          AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628           GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640            GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639              GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625               GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493                GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCATTT+61117516111762-119-108
 OsREG419AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432   AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.