version
PlantPromoterDB promoter information of AK065743

Summary of Gene (AK065743)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0115900        NCBI 
Gene model AK065743  
Description Endosperm lumenal binding protein.  
#
#

Overview

Focused view (chromosome 2: 843525-842326)

Genome position     
from initiation codon
011-050-B12         
012-013-C09         
012-078-E03         
013-063-C04         
015-039-B01         
015-041-E06         
016-002-C06         
016-019-H09         
016-021-E09         
016-027-C11         
AF006825            
AK119653            
J013040G16          
J013088L04          
J013097G23          
J013100O16          
J013106N23          
J013131A11          
J013146I17          
J023008L23          
J023111D18          
J033125B09          
J033125G11          
J043030J24          
J090002H17          
J090017O15          
J090040F10          
J090063L10          
J100029D20          
J100045K05          
J100072M03          
TSS from cDNA
TSS information
AK065743                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK065743

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-842672-147
TSS clone peakAclone-842638-113

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTATAAATC-842666842676-141-151
Y PatchCTCCCCTT-842673842680-148-155
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCTCGGCCCGTT-842689842701-164-176
 OsREG485ATCTCGGC      PPDB Motif  PLACE Motif 
 OsREG635 TCTCGGCC     PPDB Motif  PLACE Motif 
 OsREG575  CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG568   TCGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG424     GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGCCACGTGTCG-842764842773-239-248
 OsREG434CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509 CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG452  ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGCTCCCCCA-842805842812-280-287
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGCGGACGGCC-842817842825-292-300
 OsREG562CGGACGGC  PPDB Motif  PLACE Motif 
 OsREG624 GGACGGCC PPDB Motif  PLACE Motif 
REGCCGTCGGATC-842833842842-308-317
 OsREG546CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGCCCACCAC-842866842873-341-348
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCACGCCAC-842883842890-358-365
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGCGGGTCCC-842912842919-387-394
 OsREG569CGGGTCCC PPDB MotifGGGACCC  PLACE Motif 
REGGCCCAGTA-842922842929-397-404
 OsREG604GCCCAGTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.