version
PlantPromoterDB promoter information of AK065876

Summary of Gene (AK065876)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0123200        NCBI 
Gene model AK065876  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 2: 1213506-1214705)

Genome position     
from initiation codon
012-073-F02         
016-017-F04         
J013047J07          
J013073J17          
J033057C03          
J033087C11          
J033108J20          
J043015P08          
TSS from cDNA
TSS information
AK065876                         5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK065876

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+1214007J033057C03, J033108J20, 016-017-F04, J033087C11, J043015P08

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCCC+12140091214016016-017-F04, J033057C03, J033087C11, J033108J20, J043015P08
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAACGGCCCGGT+12137291213740016-017-F04, J033057C03, J033087C11, J033108J20, J043015P08
 OsREG420AAACGGCC     PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423 AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG446  ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544   CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG441    GGCCCGGT PPDB Motif  PLACE Motif 
REGAGGTGGGCCCCACCTG+12138751213890016-017-F04, J033057C03, J033087C11, J033108J20, J043015P08
 OsREG476AGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGGCCCACGC+12139181213925016-017-F04, J033057C03, J033087C11, J033108J20, J043015P08
 OsREG602GCCCACGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.