version
PlantPromoterDB promoter information of AK066143

Summary of Gene (AK066143)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0260100        NCBI 
Gene model AK066143  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 3: 8493859-8492660)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK066143                         5'->3' (-)
Promoter sequence





 
                    
Os03g0260266        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066143

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-8492569-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCCC-84925938492603-84-94
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCCCACGGCCCACCA-84926148492631-105-122
 OsREG653GTGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG         PPDB MotifGCCCA  PLACE Motif 
 OsREG547   GCCCACGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG521     CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504      CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445       ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564        CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628         GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599          GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCCCACA-84926978492709-188-200
 OsREG607TGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCAACA-84927478492757-238-248
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCATCA-84927768492786-267-277
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGAACGGGCCCATGG-84927968492808-287-299
 OsREG424AACGGGCC      PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG489   GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517    GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525     GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.