version
PlantPromoterDB promoter information of AK066182

Summary of Gene (AK066182)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0581300        NCBI 
Gene model AK066182  
Description Similar to Lycopene epsilon-cyclase (Fragment).  
#
#

Overview

Focused view (chromosome 1: 24190945-24192144)

Genome position     
from initiation codon
AK072015            
TSS from cDNA
TSS information
AK066182                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066182

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+24191858-87
TSS clone peakAclone+24191871-74

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTCCCTCCTCCT+2419181024191827-135-118
Y PatchCCTCCTCCTCCTCCTCC+2419190324191919-42-26
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGCCCATAGCAGCCCATAT+2419159824191619-347-326
 OsREG644TCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA            PPDB MotifGCCCA  PLACE Motif 
 OsREG591           GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491            CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465             AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480              GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCAAC+2419164924191658-296-287
 OsREG647GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGGGTGGGGC+2419167624191683-269-262
 OsREG612GGTGGGGC PPDB Motif  PLACE Motif 
REGTTCGTGGGGCCC+2419173524191746-210-199
 OsREG529TTCGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG572  CGTGGGGC   PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC  PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGTG+2419176224191770-183-175
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.