version
PlantPromoterDB promoter information of AK066583

Summary of Gene (AK066583)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0114700        NCBI 
Gene model AK066583  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 671292-670093)

Genome position     
from initiation codon
011-006-G03         
AK065865            
AK070834            
AK072543            
J013045I09          
J013072K15          
J023031K06          
J023073C11          
J023120G03          
J023131I22          
J065171K10          
J065179J23          
J065205D15          
J065217J11          
J090098P12          
TSS from cDNA
TSS information
AK066583                         5'->3' (-)
Promoter sequence







 
J075027C21          
J075039G16          
J075139I09          
J090037M02          
J090060L22          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066583

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-670704-412
TSS clone peakTclone-670682-390
TSS cloneGclone-670671-379

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTTCCTCTT-670673670687-381-395
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAGCCCACGA-670756670767-464-475
 OsREG419AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG427  AAGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG463   AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601    GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCGTGG-670787670798-495-506
 OsREG478AGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504   GGGCCGTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG521    GGCCGTGG PPDB Motif  PLACE Motif 
REGTGGTGGGCT-670804670812-512-520
 OsREG599TGGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG462 GGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGCGGAGAG-670928670935-636-643
 OsREG576GCGGAGAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.