version
PlantPromoterDB promoter information of AK066659

Summary of Gene (AK066659)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0844900        NCBI 
Gene model AK066659  
Description Homeodomain-like containing protein.  
#
#

Overview

Focused view (chromosome 1: 38042198-38043397)

Genome position     
from initiation codon
AK099801            
AK103686            
J013045N04          
J013069H16          
J013091C07          
J013098A15          
J023037D19          
J023039C09          
J033052H09          
J033071M04          
J033081H22          
J033087D17          
J033116E10          
J033136F19          
J033143C20          
J043026B13          
J065095C16          
J065205J01          
J090006C14          
J090007F13          
J090016K21          
J090018B17          
J090024B17          
J090024M17          
J090030M06          
J090032H20          
J090038G04          
J090057M09          
J090073G01          
J090078J01          
J090079N23          
J100050H14          
TSS from cDNA
TSS information
AK066659                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066659

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+38043129-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCTTCCTCTTCCTC+3804315338043172-45-26
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCGTCC+3804290538042912-293-286
 OsREG442ACGCGTCC PPDB Motif  PLACE Motif 
REGGCGCGCGAC+3804292138042929-277-269
 OsREG617GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG557 CGCGCGAC PPDB MotifACGCGC  PLACE Motif 
REGTCCGACGG+3804293338042940-265-258
 OsREG546TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCCCACTCC+3804295838042965-240-233
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 
REGCTCGCGCGC+3804296738042975-231-223
 OsREG558CTCGCGCG  PPDB MotifACGCGC  PLACE Motif 
 OsREG617 TCGCGCGC PPDB Motif  PLACE Motif 
REGCATCCACC+3804299938043006-199-192
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGGCTGGGCCCC+3804303238043041-166-157
 OsREG620GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGGGGACCCACCCG+3804307438043085-124-113
 OsREG637GGGACCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG622 GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG528    CCCACCCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.