version
PlantPromoterDB promoter information of AK066686

Summary of Gene (AK066686)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0147700        NCBI 
Gene model AK066686  
Description Region of unknown function, putative Zinc finger, XS and XH domain containing protein.  
#
#

Overview

Focused view (chromosome 1: 2583470-2582271)

Genome position     
from initiation codon
011-068-H06         
J013070L04          
J013071J06          
J023002C08          
J090007N15          
J090021E02          
J090025L19          
J090071F22          
TSS from cDNA
TSS information
AK066686                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066686

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-2582575-105

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCCCCCTTCC-25825762582591-106-121
Y PatchTCCCCCTC-25825932582600-123-130
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACAGGTGGGACCCACCCG-25826342582652-164-182
 OsREG501GACAGGTG            PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG           PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG651    GGTGGGAC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG650     GTGGGACC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG648      TGGGACCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG637       GGGACCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG622        GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG528           CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCT-25826632582672-193-202
 OsREG627TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475  TGGGCCCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.