version
PlantPromoterDB promoter information of AK066705

Summary of Gene (AK066705)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0530300        NCBI 
Gene model AK066705  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 4: 26927835-26926636)

Genome position     
from initiation codon
009-053-E04         
009-074-E03         
TSS from cDNA
TSS information
AK066705                         5'->3' (-)
Promoter sequence







 
AK067634            
J013108A04          
J033051B13          
J065060E01          
J065083I08          
J065121J16          
J065140C14          
J065213O18          
J100028L17          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066705

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-26926918-83
TSS clone peakTclone-26926916-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCCCCTCCT-2692687726926891-42-56
Y PatchCCTCTCCT-2692689426926901-59-66
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACACGTGCTGGGCTGCTGGCCCACATGTCAGTG-2692696726927000-132-165
 OsREG509GACACGTG                           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG464       GCTGGGCT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG512        CTGGGCTG                   PPDB MotifGCCCA  PLACE Motif 
 OsREG591         TGGGCTGC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG577                CTGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG654                 TGGCCCAC          PPDB MotifGCCCA  PLACE Motif 
 OsREG627                  GGCCCACA         PPDB MotifGCCCA  PLACE Motif 
 OsREG510                          TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGAGACGCG-2692701226927019-177-184
 OsREG560GAGACGCG PPDB Motif  PLACE Motif 
REGGAGGCGTG-2692702526927032-190-197
 OsREG503GAGGCGTG PPDB Motif  PLACE Motif 
REGTGGGGGAG-2692707226927079-237-244
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 
REGCGTCGGATCGG-2692708926927099-254-264
 OsREG483CGTCGGAT    PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588 GTCGGATC   PPDB MotifCCGAC  PLACE Motif 
 OsREG541   CGGATCGG PPDB Motif  PLACE Motif 
REGGACGTGGC-2692715326927160-318-325
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTTGTGGGC-2692717426927181-339-346
 OsREG597TTGTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+26927057AK067634, AK067634

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTC+2692701726927025AK067634
Y PatchCCCCTCTC+2692703726927044AK067634
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGAGCCG+2692681126926818AK067634
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGCTCGGCCCAGT+2692693326926943AK067634
 OsREG575CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT PPDB MotifGCCCA  PLACE Motif 
REGCACTGACATGTGGGCCAGCAGCCCAGCACGTGTC+2692696726927000AK067634
 OsREG510CACTGACA                           PPDB Motif  PLACE MotifTGAC 
 OsREG627        TGTGGGCC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG654         GTGGGCCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG577          TGGGCCAG                 PPDB MotifGCCCA  PLACE Motif 
 OsREG591                 GCAGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG512                  CAGCCCAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG464                   AGCCCAGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG509                          CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.