version
PlantPromoterDB promoter information of AK066929

Summary of Gene (AK066929)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0602300        NCBI 
Gene model AK066929  
Description Similar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).  
#
#

Overview

Focused view (chromosome 2: 24430556-24431755)

Genome position     
from initiation codon
AK065609            
J013033D17          
J013092L08          
J090040I23          
TSS from cDNA
TSS information
AK066929                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066929

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+24430826-730

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTCTATAT+2443078824430796-768-760
Y PatchCTCCTCTCCT+2443081924430828-737-728
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCCACGTG+2443057224430584-984-972
 OsREG615GCCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG449    GCCCACGT  PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508     CCCACGTG PPDB MotifACGT  PLACE Motif 
REGGCCGGCCC+2443059024430597-966-959
 OsREG615GCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCCGGC+2443061824430628-938-928
 OsREG615GCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG544  CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC PPDB Motif  PLACE Motif 
REGGTGGTGGGCCGTGCCTGGGCCGCGCACGCG+2443064224430671-914-885
 OsREG527GTGGTGGG                       PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG                    PPDB MotifGCCCA  PLACE Motif 
 OsREG445    TGGGCCGT                   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504     GGGCCGTG                  PPDB MotifGCCCA  PLACE Motif 
 OsREG550             CCTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG565              CTGGGCCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG618               TGGGCCGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG555                      CGCACGCG PPDB Motif  PLACE Motif 
REGGGGCCGGC+2443067824430685-878-871
 OsREG615GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCG+2443069024430698-866-858
 OsREG504CACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGGGACACGTG+2443070424430712-852-844
 OsREG451GGACACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGAACGGGCCGTG+2443071724430727-839-829
 OsREG424AACGGGCC    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG446  CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504   GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGAACGGGCCGTG+2443073224430742-824-814
 OsREG424AACGGGCC    PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG446  CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG504   GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGCCGTGGGCCGTG+2443075324430764-803-792
 OsREG547CCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCGGCCCACCTG+2443076824430785-788-771
 OsREG614GCCCGGCC           PPDB Motif  PLACE Motif 
 OsREG615     GCCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564       CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628        GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476         GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514          CCCACCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.