version
PlantPromoterDB promoter information of AK066932

Summary of Gene (AK066932)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0161200        NCBI 
Gene model AK066932  
Description Similar to Sulfate transporter 3.1 (AST12) (AtST1).  
#
#

Overview

Focused view (chromosome 3: 3256105-3254906)

Genome position     
from initiation codon
011-052-C08         
J013093F02          
J013158G03          
J023034I21          
J023037L24          
J023056D15          
J023139P10          
J090023L13          
J090031O21          
J090084C16          
TSS from cDNA
TSS information
AK066932                         5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066932

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-3255214-109

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGCTATATATATC-32552403255253-135-148
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGTGGGCCCC-32553093255320-204-215
 OsREG527GTGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGCCCACACG-32553283255335-223-230
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGGGACACGTCTCACTGACAGGTGGGACCCAC-32553593255388-254-283
 OsREG451GGACACGT                       PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG506   CACGTCTC                    PPDB MotifACGT  PLACE Motif 
 OsREG510          CACTGACA             PPDB Motif  PLACE MotifTGAC 
 OsREG453           ACTGACAG            PPDB Motif  PLACE MotifTGAC 
 OsREG551            CTGACAGG           PPDB Motif  PLACE MotifTGAC 
 OsREG501              GACAGGTG         PPDB Motif  PLACE Motif 
 OsREG436               ACAGGTGG        PPDB Motif  PLACE Motif 
 OsREG514                CAGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG651                  GGTGGGAC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650                   GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648                    TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637                     GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622                      GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGCCACACG-32554133255420-308-315
 OsREG573GCCACACG PPDB Motif  PLACE Motif 
REGCCCCCGCG-32554303255437-325-332
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGCCCAACT-32554463255453-341-348
 OsREG479GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGGTGACGTGTCC-32554593255470-354-365
 OsREG447GGTGACGT     PPDB MotifACGT  PLACE MotifTGAC 
 OsREG505 GTGACGTG    PPDB MotifACGT  PLACE MotifTGAC 
 OsREG451    ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.