version
PlantPromoterDB promoter information of AK066978

Summary of Gene (AK066978)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0777800        NCBI 
Gene model AK066978  
Description Similar to Avr9/Cf-9 induced kinase 1.  
#
#

Overview

Focused view (chromosome 2: 33805569-33804370)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK066978                         5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK066978

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33805375-806

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATACCCC-3380539533805403-826-834
Y PatchCTCTCTCCC-3380532933805337-760-768
Y PatchTCCTCCCTC-3380535333805361-784-792
Y PatchCCTCCTCTT-3380540533805413-836-844
Y PatchCCTCCCTC-3380541733805424-848-855
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCCCCACACGCCTC-3380542533805440-856-871
 OsREG438ACCCCCCA         PPDB Motif  PLACE Motif 
 OsREG535   CCCCACAC      PPDB Motif  PLACE Motif 
 OsREG526    CCCACACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG503        CACGCCTC PPDB Motif  PLACE Motif 
REGCGCGCGAC-3380550433805511-935-942
 OsREG557CGCGCGAC PPDB MotifACGCGC  PLACE Motif 
REGGGCCGTTT-3380551633805523-947-954
 OsREG420GGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGTGTGGGC-3380554933805557-980-988
 OsREG526CGTGTGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG598 GTGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGAGCCGTCCG-3380556333805571-994-1002
 OsREG468AGCCGTCC  PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG PPDB Motif  PLACE Motif 
REGCCCCCGCG-3380559133805598-1022-1029
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGGACGGCC-3380564833805655-1079-1086
 OsREG624GGACGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.