version
PlantPromoterDB promoter information of AK067079

Summary of Gene (AK067079)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0113000        NCBI 
Gene model AK067079  
Description Amino acid-binding ACT domain containing protein.  
#
#

Overview

Focused view (chromosome 5: 678684-679883)

Genome position     
from initiation codon
J013132K08          
J023028N09          
J023085P10          
J023112H24          
J023139E23          
J023139J06          
J033024K22          
J033133M23          
TSS from cDNA
TSS information
AK067079                         5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067079

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+679602-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGTGGGCCCAACC+679426679440-258-244
 OsREG498CAAGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639     GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626      GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595       GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCCACCTG+679470679484-214-200
 OsREG627TGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.