version
PlantPromoterDB promoter information of AK067084

Summary of Gene (AK067084)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0836200        NCBI 
Gene model AK067084  
Description Similar to RNA-binding protein RZ-1.  
#
#

Overview

Focused view (chromosome 3: 35988236-35987037)

Genome position     
from initiation codon
009-165-F07         
015-092-G01         
AK058443            
AK101225            
J013092A03          
J013095N17          
J013147J18          
J023019O10          
J023065N18          
J033031E20          
J033113E18          
J033133E03          
J065059J15          
J065075O11          
J065119I07          
J065171J03          
J090016D21          
J090081O03          
J100040G18          
J100040L10          
J100055H13          
J100059I22          
J100078A08          
TSS from cDNA
TSS information
AK067084                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067084

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-35987999-763
TSS clone peakAclone-35987994-758
TSS cloneAclone-35987992-756

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATAAAAA-3598802735988038-791-802
Y PatchCCCCTCTCCT-3598803435988043-798-807
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGGCCCCACA-3598812335988133-887-897
 OsREG567CGGGCCCC    PPDB MotifACGGGC  PLACE Motif 
 OsREG641 GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631  GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611   GCCCCACA PPDB Motif  PLACE Motif 
REGTCGTGGGC-3598813735988144-901-908
 OsREG601TCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGCCCCACCTG-3598815135988166-915-930
 OsREG600GGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCACAAGCGGCCCAACT-3598819835988220-962-984
 OsREG575CTCGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC              PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA             PPDB MotifGCCCA  PLACE Motif 
 OsREG597    GCCCACAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG618            GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563             CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626              GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479               GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.