version
PlantPromoterDB promoter information of AK067164

Summary of Gene (AK067164)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0844100        NCBI 
Gene model AK067164  
Description Similar to Pti1 kinase-like protein.  
#
#

Overview

Focused view (chromosome 3: 36337319-36336120)

Genome position     
from initiation codon
014-095-G11         
J013094N20          
J053063O09          
J065035B07          
J090024I22          
TSS from cDNA
TSS information
AK067164                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK067164

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-36337039-720

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCCCCTCCC-3633705136337064-732-745
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCTGTC-3633719036337199-871-880
 OsREG514CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501  CACCTGTC PPDB Motif  PLACE Motif 
REGTAATGGGCCCCACGTCTC-3633720536337222-886-903
 OsREG610TAATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450       CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG506          CACGTCTC PPDB MotifACGT  PLACE Motif 
REGCCAGCCCAACC-3633723136337241-912-922
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595   GCCCAACC PPDB MotifGCCCA  PLACE Motif 
REGAAACGGCC-3633725036337257-931-938
 OsREG420AAACGGCC PPDB MotifAAACG(C/G)  PLACE Motif 
REGCCCACACG-3633730536337312-986-993
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.